Perl assignment

  • Bids0
  • Budget $0.00
  • Average Bid $0.00

Posted on

Active
Bid

Project Desciption

1.Create a Perl Script that will translate the following DNA sequence (ATGCTGACCATTTTCTTTTCCTCCACTGAAGCA)

into the 6 possible amino acid sequences (that means the 3 frame shift sequences of the original and the 3-frame shift sequences of the reverse complement). Submit your code as well as the amino acid sequences.

2. Use a Perl Script to compare the query sequence to each of the subject sequences in this alignment below to identify which subject sequence has the highest sum of BLOSUM62 comparison score? ( another question (exactly like this one.))

Employer Information

2250 project(s) posted hire 2 freelancers
Member since: 2020-02-01
FREELANCER BIDDING (0)

There are no bids yet.

Open chat
1
Whatapp Us
Hey? You want your project done, Whatsapp us Now.
Click to Submit a Project